ISSN: 2168-9547
Molecular Biology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Protocatechualdehyde Induces Apoptosis In Human Non-Small-Cell Lung Cancer Cells By Up Regulation Of Growth Arrest And DNA Damage-Inducible (GADD) Genes

Satyajit Patra1*, Roshan Mascarenhas2, Naseer Maliyakkal3 and Jesil Mathew Aranjani4
1Department of Pharmacology, Medical University of the Americas, Nevis, West Indies
2Department of Molecular and Cellular Biochemistry, The Ohio State University, Columbus, OH 43210, USA
3Manipal College of Pharmaceutical Sciences, Manipal University, Manipal, India 576104
4Department of Pharmaceutical biotechnology, Manipal College of Pharmaceutical Sciences, Manipal, India
Corresponding Author : Satyajit Patra
Department of Pharmacology
Medical University of the Americas
Nevis, West Indies
Tel: +1 869-469-9177
Fax: +1 869-469-9180
Received September 18, 2013; Accepted October 18, 2013; Published October 25, 2013
Citation: Patra S, Mascarenhas R, Maliyakkal N, Aranjani JM (2013) Protocatechualdehyde Induces Apoptosis in Human Non-Small-Cell Lung Cancer Cells by up Regulation of Growth Arrest and DNA Damage-Inducible (GADD) Genes. Mol Biol 2:113. doi:10.4172/2168-9547.1000113
Copyright: © 2013 Patra S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Molecular Biology: Open Access


Growth arrest and DNA damage-inducible (GADD) 45 and GADD153 proteins have been implicated in DNA repair, cell cycle regulation and growth arrest along with numerous other cellular mechanisms. In recent years, evidence has emerged that proteins encoded by these genes play pivotal roles in tumor suppression and apoptotic cell death. Thus, compounds altering the expression of these genes are likely to be of interest in cancer prevention and/or treatment. Protocatechualdehyde is isolated from Phellinus gilvus and has been investigated as a promising cancer preventive agent because of its medicinal properties. This mushroom belongs to Hymenochaetaceae Basidiomycetes, and has advantages over many Phellinus species due to short growth period (3 months), making production cost-effective. The exact molecular mechanisms of protocatechualdehyde are not clearly understood. Based on studies of pro-apoptotic activity of protocatechualdehyde in T-cells and colorectal cancer cells, we examined the relationship between the expression of GADD45 and GADD153 and apoptosis induction in human lung cancer cell line PC-9. We report a p53-independent increase in GADD45 and GADD153 expression by protocatechualdehyde. Likewise, the proliferation of PC-9 cells is inhibited via a G1/S arrest of the cell-cycle stimulating apoptosis. Further, induction of apoptosis was inhibited in PC-9 cells knocked down for GADD45 and GADD153. Protocatechualdehyde treatment also induced the expression of cell cycle inhibitors p21 and p27, while inhibiting Bcl-2, cyclin D1, CDK2, CDK4 and CDK6 genes. These findings suggest that upregulation of GADD45 and GADD153 proteins are the mechanism for protocatechualdehyde�s anti-tumor activities.

Protocatechualdehyde; Apoptosis; Cell-cycle; Lung cancer; Cancer prevention
Growth arrest and DNA damage-inducible (GADD) 45 and GADD153 proteins have been implicated in DNA repair, cell cycle regulation and growth arrest along with numerous other cellular mechanisms. In recent years, evidence has emerged that proteins encoded by these genes play pivotal roles in tumor suppression and apoptotic cell death. The GADD45 expression is rapidly regulated at both transcriptional and post-transcriptional levels in response to genotoxic stress via p53 tumor suppressor pathway or by mRNA stability as well as other growth-arrest signals [1]. Several studies have correlated GADD153 expression with cell death by treating the cells to different stress conditions especially with DNA damaging agents. Because of the involvement of GADD45 protein with the cell cycle, apoptosis, DNA repair and stability makes it an obvious target for cancer therapy [2]. Previous studies show that GADD45 and GADD153 proteins play key roles in the induction of programmed cell death and thus we sought to investigate their role in human lung cancer. In this study two GADD genes (GADD45 and GADD153) were studied representing a p53- dependent and a p53-independent pathway respectively.
Lung cancers are carcinomas that derive from epithelial cells with small-cell lung carcinoma (SCLC), and non-small-cell lung carcinoma (NSCLC) being the main types. The estimated deaths from lung cancer is 159,480 (87,260 in men and 72,220 among women), accounting for about 27% of all cancer deaths [3]. Worldwide, there are 2.28 million new cases of lung cancer annually, with 1.59 million deaths, making lung cancer a leading cause of cancer-related mortality and account for an estimate of about 14% of all new cancers [4]. Tobacco use, particularly of smoking, is the main contributor to lung cancer; however, a significant number of non-smoking individuals are reported with lung cancer [5]. Males show higher mortality rate because of increased risk of lung cancer associated with cigarette smoking [6]. approximately reporting 63,000 new lung cancer cases each year in India [7]. Impediment in early detection and diagnosis of advanced stage is the main reason for high mortality [8]. The best strategy is to minimize the development of lung cancer using cancer preventive agents. There is a strong interest in cancer prevention with widely investigated natural products, such as capsaicin, green tea, turmeric, cardamom and resveratrol.
Protocatechualdehyde which is isolated from Phellinus gilvus, has been investigated as a promising cancer preventive agent because of its medicinal properties. This mushroom belongs to Hymenochaetaceae Basidiomycetes, and has advantages over many Phellinus species due to short growth period (3months), making production costeffective [9-11]. Previous studies have established various biological activities of protocatechualdehyde. Among the reported benefits of protocatechualdehyde are inhibition of pulmonary inflammation, prevention of intraperitoneal adhesion under infectious circumstances, promotion of dermal wound healing, anti-platelet aggregation and antitumor activities [9,10,12,13]. Protocatechualdehyde has been a subject of continuous interest because of its effective scavenging property for oxygen free radicals [14,15]. DPPH (2,2-diphenyl-1- picrylhydrazyl) free radical scavenging and xanthine-oxidase (XO)- inhibitory activities, antioxidant/anti-inflammatory activities of protocatechualdehyde have been evaluated. Apoptotic cell death induced by protocatechualdehyde is demonstrated in different cells. The exact molecular mechanisms of protocatechualdehyde are not clearly understood [16-19]. Since protocatechualdehyde is well studied to have therapeutic effects on various types of diseases, the cancer preventive activity of protocatechualdehyde is of very much interest, and experiments with protocatechualdehyde in animal models indicate the protective nature against several diseases. Specifically, protocatechualdehyde inhibited cell growth of various cancer cell lines, and induced apoptosis of cancer cells [16,20-22]. Moreover, protocatechualdehyde was shown effective on cell-cycle regulation of the mammalian cell line [17]. Based on these findings, we investigated the molecular mechanisms of cancer preventive and anti-cancer activities of protocatechualdehyde for lung cancer prevention in humans, and this study provides the first report on role of protocatechualdehyde in the prevention of lung cancer in human.
Numerous reports have focused on evidence that the cancer preventive activity is stimulated by altering the phases of cell cycle, associated with the modulation of their regulatory components [23,24]. This suggests that these genes are induced by stimulation of GADD45 and GADD153 in response to DNA damage and growth arrest, which is shown in many cell types. In this study we report the anti-proliferative effects of protocatechualdehyde on human lung cancer cell lines PC-9 and A549 by inducing GADD45 and GADD153 by p53 independent manner. These results add to our knowledge on importance of protocatechualdehyde on lung cancer prevention.
Materials and Methods
Chemicals and reagents
Protocatechualdehyde, 4’, 6-diamidino-2-phenylindole (DAPI), and propidium iodide (PI) were purchased from Sigma-Aldrich Pvt. Ltd. (India). Antibodies specific for GADD45, GADD153 and GAPDH were obtained (Santa Cruz Biotechnology, Santa Cruz, CA).
Cell culture and transfection
The human non-small cell lung cancer cell lines A549 and PC-9 were cultured in DMEM-F12 supplemented with 10% HyClone fetal bovine serum (FBS) (ThermoFisher Scientific, Fremont, CA, USA) in an atmosphere of 5% CO2 at 37°C. Cells were grown in 75 cm2 culture flasks and harvested in a solution of trypsin-EDTA at the logarithmic growth phase.
PC-9 cells were transfected with human GADD45 and GADD153 specific siRNAs prepared by Invitrogen. Stealth RNAi negative control duplex (Invitrogen) was used as a control. The siRNA targeting GADD45 corresponds to the sequence GAGCAGAAGACCGAAAGGAUGGAUA, and the siRNA targeting GADD153 corresponds to the sequence GAGAAUGAACGGCUCAAGCAGGAAA. PC-9 cells were transfected using Lipofectamine RNAi max (Invitrogen), according to manufacturer’s instruction. In brief, 1.4 × 106 PC-9 cells were transfected with final concentration of 50 nM siRNA in six-well culture plate in triplicates. Cells were treated with protocatechualdehyde or vehicle 24 h after transfection. DAPI staining was performed for apoptosis assay. Cells were lysed in lysis buffer containing 0.2% NP- 40. Total RNA was extracted from the cells lysate using TRIzol reagent following the manufacturer’s instructions (Invitrogen).
Western blotting
Cells lysate was estimated for total protein content by Bradford assay. Total 10 μg of protein sample was run on 10% polyacrylamide gel. Subsequently transferred to a polyvinylidene difluoride (PVDF) (Millipore) membrane by semi-dry electroblotting. Blocked in 5% nonfat dry milk in TBS with Tween 20 (0.05%). Blots were incubated at RT for 1h in primary antibody at 1:1250 dilutions in blocking solution. Following washing with TBST, membranes were incubated respective horseradish peroxidase (HRP)-conjugated secondary antibody, and visualized with ECL plus western blot detection kit (GE Healthcare).
Cell viability and cell growth assay
Trypan blue dye exclusion method: PC-9 cells (1 × 104/ml) were cultured in 6-well plates for 24 h followed by treatment with different concentrations of protocatechualdehyde or vehicle as control supplemented with 10% FBS for 24-72 h with changing culture medium every 24 h. Protocatechualdehyde was dissolved in DMSO as stock solution and stored at -20°C. Trypan blue dye exclusion test [25] was used to determine the inhibition of cell growth. The result was expressed as a percentage, relative to treatment with vehicle control, and the IC50 values were calculated using non-linear regression analysis (percent survival versus concentration). Results shown are from at least three independent experiments performed in replicates.
MTT assay: Cell viability was evaluated by measuring the amount of insoluble formazan formed in live cells based on the reduction of MTT salt. Briefly, 100 μl PC-9 cell suspensions at 2 × 104 cell/ml were seeded in 96 well micro titer plate (BD, USA). Protocatechualdehyde in concentration range of 0-100 μg/ml were added. MTT reagent was added after 72 h exposure followed by dissolution of formed formazan crystal using DMSO (Sigma, USA). Optical density was read with ELISA reader (LX-800) at 550 nm. The dose-response curve is plotted and concentration that exhibited 50% inhibition of cell growth (IC50) is calculated. Concentration that inhibits 50% of cell viability was used as a parameter for cytotoxicity.
Cell-cycle analysis
To compare the effects of different concentration of protocatechualdehyde on the cell cycle, the Cycle TEST™ PLUS DNA Reagent Kit (Becton Dickinson, USA) was used. The cells (1 × 106 cells/ ml) were seeded in a 6-well plate and treated with protocatechualdehyde for 24h. After harvesting, made to suspension, permeabilized with trypsin buffer. Incubated with propidium iodide (1mg/ml) for 10 min in dark. Cells were analyzed by flow cytometry (BD FACS Calibur, USA) using BD Cell Quest acquisition and analysis software. Cell cycle phase distribution of nuclear DNA was determined by analyzing at least 10,000 cells per sample and the percentage of cells in G1, S and G2 phases.
Apoptosis assay
Identification and quantitation of apoptotic cells were done by DAPI staining. PC-9 cells were cultured overnight at the density of 5 × 105 cells/ml in a 6-well culture plate and then treated with different concentrations (0-100 μg/ml) of protocatechualdehyde for 24 h. The cells were then fixed with 500 μL fixing solution (acetic acid: methanol; 1:3) for 5 min, dried, and stained with the DNA-specific fluorochrome DAPI (2 μg/ml). Following 10 min of incubation, the cells were washed with phosphate buffered saline (PBS), air-dried, mounted with 90% (v/v) glycerol. The percentage of apoptotic cells was calculated using fluorescence microscopy (Olympus, Japan) with at least 200 randomly selected cells. Results are obtained from at least three independent experiments.
Quantitation of cell cycle and apoptosis related gene expression by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
Total RNA was extracted from cultured PC-9 cells treated with various concentrations of protocatechualdehyde for 24 h using the TRIzol reagent and then one μg of RNA subjected to reversetranscription using SuperScript® III First-Strand Synthesis System (Life Technologies, Inc.). To allow a quantitative determination of relative gene expression levels for the apoptosis related genes [26]. The cDNA content of the samples was normalized, and the linear range of amplification was determined using SYBR Green reagent for each primer set PCR on 7300 Real Time PCR System (Applied Biosystems). GAPDH expression was used as normalization control. At least two independent experiments were performed to confirm the results. The sequences of the primers used are provided in Table 1.
Statistical analysis
Statistical analyses were performed with Student’s t-test. The results were considered to be significant when p value was less than 0.05, *p<0.05, **p<0.01.
Effects of protocatechualdehyde exposure on cell viability and cell growth
Protocatechualdehyde inhibited cell growth in PC-9 cells, when exposed with various concentrations and the inhibition was dosedependent manner shown in Figure 1. After 24 h treatment with 100 μM protocatechualdehyde, the percentage of viable cells was 47.3% of the vehicle control and after 48h treatment with 75 and 100 μM protocatechualdehyde viable cells reduced to 48.6 and 31.0% of control. The lowest and highest dose with significant changes were observed at 50 μM and 100 μM respectively, above which no considerable changes were observed and therefore these two doses were used in the study for analysis of role of protocatechualdehyde on expression of gene of interest.
Protocatechualdehyde induce apoptosis of PC-9 Cells
We determined the mechanisms of growth inhibition activity of PC-9 cell lines and further investigated apoptosis of PC-9 cells by morphological changes with DAPI staining. Cells were treated with various concentrations of protocatechualdehyde and percentage of apoptotic cells increased dose-dependent manner and cells with condensed and fragmented nuclei were observed. After 48 h treatment of cells with protocatechualdehyde at 25, 50, 75 and 100 μM concentrations, apoptosis was induced as 11.4, 32.5, 41.5 and 62.3% of cells respectively (Figure 2). From the above results it was confirmed that protocatechualdehyde treated cells shows alterations in the expression of GADD genes, growth inhibition, and stimulation of cell cycle arrest and apoptosis.
Effect of protocatechualdehyde on cell cycle regulation in PC-9 Cells
Regulatory effects of protocatechualdehyde on the cell cycle were evaluated in PC-9 cells. Protocatechualdehyde at a concentration of 100 μΜ in PC-9 cells significantly increased the cells of G1 phase from 46.6 to 63.2% (Figure 3, Table 2). PC-9 cells when treated with protocatechualdehyde at concentrations of 25 and 50 μΜ for 24 h, an accumulation of S phase respectively was observed (Figure 3, Table 2).The growth inhibition was linked to protocatechualdehyde induced G1 and S phase arrests in the cell cycle in PC-9 cells.
Protocatechualdehyde induced expression of genes associated with cell cycle and apoptosis
The eukaryotic cell cycle is regulated by the periodic synthesis and destruction of cyclins and their cyclin-dependent kinases and negatively controlled by cyclin-dependent kinases inhibitors (called CDIs) [27]. Expressions of these cell-cycle regulatory genes like Cyclin D1, CDK2, CDK4 and CDK6 were determined in protocatechualdehyde treated PC-9 cells for understanding the mechanisms of apoptosis. Expression of genes and fold changes were evaluated by quantitative real-time PCR after 24 h of treatment with protocatechualdehyde in PC-9 cells. Transcript levels of cyclin D1, CDK2, CDK4 and CDK6 genes found to be decreased, as shown in Figure 4. In particular, after 24 h protocatechualdehyde at 100 μΜ concentration, the mRNA levels of cyclin D1, CDK2, CDK4 and CDK6 were down-regulated 0.28, 0.31, 0.42 and 0.61 fold, compared with that of vehicle control. However, after 24 h treatment of protocatechualdehyde at a concentration of 100 μΜ significantly increased the mRNA levels of the CDK inhibitors p21 and p27 to 17.46 and 5.96 fold (Figure 4). Protocatechualdehyde in PC-9 cells decreased the expression of Bcl-2 (Figure 4) and there was no change in expression of Bax gene.
Protocatechualdehyde induces GADD45 and GADD153 gene expression
GADD45 and GADD153 genes were up regulated with protocatechualdehyde treatment in PC-9 cell line. Though the increased expression was time and dose dependent still 100 μΜ protocatechualdehyde dosages increased 29.2 and 21.6 fold expression after 24 h incubation (Figure 5). Protocatechualdehyde treated human lung cancer cells A549 cells with wild type p53 also showed similar increased expression of GADD45 and GADD153. These results suggest p53-independent induction of GADD45 and GADD153 by protocatechualdehyde. Above observation was confirmed at protein level by western blotting for GADD45 and GADD153 proteins and shown increase in protein level as shown in Figure 5.
Protocatechualdehyde on GADD45 and GADD153 knockdown:
From the above observations it was clear that protocatechualdehyde induces the GADD45 and GADD153 gene expression with consequential in apoptotic induction. Functions and involvement of GADD45 and GADD153 genes were explored to study the mechanisms of apoptotic induction using siRNA-mediated knockdown of GADD45 and GADD153. PC-9 cells were treated with GADD45 and GADD153 siRNAs for 24 h, and expressions of the GADD45 and GADD153 genes that were induced by 100 μΜ protocatechualdehyde was inhibited (Figure 6A). Furthermore, protein production of GADD45 and GADD153 in PC-9 cells induced by protocatechualdehyde (was also inhibited by the siRNAs (Figure 6B). It was apparent to study the relationship between the reduction of GADD45 and GADD153 proteins and its effect on the apoptotic induction by protocatechualdehyde in PC-9 cells.
In comparison with the control experiments where the percentage of apoptotic cells were 20.0 and 33.0%, siRNA induced apoptosis in 24.0 and 35.6% of PC-9 cells treated with 50 and 100μM protocatechualdehyde, respectively, at 24 h (Figure 6C). However, PC-9 cells treated with GADD45 and GADD153 siRNA, showed significantly lower sensitivity towards the apoptotic induction by protocatechualdehyde: 11.0 and 11.8% at 50 μM, and 15.6 and 16.2% at 100 μM, respectively (Figure 6C). From the above observations it was evident that, both the GADD45 and GADD153 genes play significant role in protocatechualdehyde-induced apoptosis and shall be targeted for controlling the apoptosis process in the PC-9 cells.
In the present study, we determined the growth inhibitory activities and IC50 values of protocatechualdehyde and induction of G1/S phase cell cycle arrest and apoptosis in colon cancer PC-9 cells. Earlier studies revealed that protocatechualdehyde was able to exert consistent antiproliferative activity indicating arrest from G1 to S in various cancer cells, such as human colorectal cancer cells and smooth muscle cells [16,28]. The G1/S checkpoint is primarily controlled by collective kinase activities of the complex of cyclin D with CDK4, CDK6 and cyclin E and these G1 kinases can in turn be regulated by cell cycle inhibitors, which may cause the cells to arrest at the G1 phase [29]. To evaluate the cell cycle inhibitor effect of protocatechualdehyde, we investigated changes in regulation of putative G1 cyclin such as cyclin D1 and the cyclin dependent kinase CDK2, CDK4, CDK6 and observed that cell-cycle arrest is associated with downregulation of these cell cycle regulators [30]. Nuclear protein Cyclin D1, an essential regulator of G1 to S phase progression, is tightly associated, and aberrantly expressed in numerous human cancers [31] including human lung tumors, and several other types of human cancer [32]. Cyclin D1 is frequently overexpressed in various forms of cancer including nonsmall cell lung carcinoma (NSCLC) [33] and decrease in the level of expression of Cyclin D1 inhibits growth and reverses the transformed phenotype of human esophageal cancer cells [34]. Phosphorylation of the retinoblastoma (Rb) protein during the G1/S transition of the cell cycle appears to be initiated by Cyclin D/CDK4 and from this study we believe that protocatechualdehyde exerts its effect by cell cycle arrest in G1 phase in PC-9 cells by reducing the expression of Cyclin D1 and CDK4/6 genes. Also the expression of CDK2 is decreased, demonstrating the importance of CDK2 in the regulation of the cell cycle G1 checkpoint [35]. CDK inhibitor such as p21 is found associated with multiple Cyclin-CDK complexes, phosphorylated p21 binds simultaneously to both cyclin and CDKs and cyclin/CDK complexes are regulated by p21 [23]. Indeed, p21 is a potent CDK inhibitor and displays selectivity for G1, and over-expression of p21 arrest cells in the G1 phase of the cell cycle [36,37]. Protocatechualdehyde reportedly affects cell proliferation and apoptosis in human colorectal cancer cells and define potential mechanisms by which protocatechualdehyde mediate growth arrest and apoptosis of cancer cells. Protocatechualdehyde decreases Cyclin D1 expression in protein and mRNA level and suppress luciferase activity of Cyclin D1 promoter, indicating transcriptional downregulation of cyclin D1 gene in human colorectal cancer cells. It was recently reported that suppressed cell proliferation by G1 arrest and induced apoptosis in human colorectal cancer cells [16] and the effect may mediated by apoptosis through upregulation of p21, in view of the fact that upregulation p21 may promote apoptosis. We hypothesized that protocatechualdehyde inhibited the growth of PC-9 cells and induced G1/S arrest of the cell cycle by upregulation of p21 expression. Another member of the CDK inhibitor family p27/ Kip1 binding to Cyclin E-CDK2 complexes and the binding dependent phosphorylation of p27 is involved in the transition of G1 to S phase resulting in tumor suppression [38,39]. Earlier studies present strong evidence that the lack of functional p27 has a profound effect on tumorigenesis and is a major factor in the development of human tumors [40-43]. Up-regulated p27 protein activity in PC-9 cells treated with protocatechualdehyde signifies that the p27 gene upregulation is associated with cancer preventive activity [23].
To explore the possible association between GADD45 and GADD153 genes with apoptosis in PC-9 cells treated with protocatechualdehyde, we examined the knockdown of GADD45 and GADD153 gene expressions by siRNA in PC-9 cells. However, no significant change in the expression of cell-cycle regulating gene including p21, p27, cyclin D1, CDK2, CDK4, and CDK6 were observed. From our result, the observed G1/S cell-cycle arrest by protocatechualdehyde in PC-9 cells may be associated with the variation of cell-cycle regulators by protocatechualdehyde. A significant observation in this study is that, expression of GADD45 and GADD153 genes in both p53 mutated PC-9 cells and p53 wild type A549 cells was up-regulated by treatment with protocatechualdehyde, indicating that p53 protein does not have direct stimulatory effect on expression of GADD45 and GADD153. The present study was designed to determine whether protocatechualdehyde increased expression of the gene GADD 45 and GADD153, which are induced by genotoxic stress through p53-dependent and -independent pathways. GADD45 and GADD153 gene expressions are induced by deoxycholate in both HCT-116 colonocytes with wild type p53 and p53 mutant HCT-15 colonocytes [44]. GADD proteins have been shown to inhibit proliferation and stimulate DNA repair and/or apoptosis [45]. The induced effect of protocatechualdehyde on these gene expressions in PC-9 and A549 cells would be independent of p53 as it was reported with other genotoxic agents. One observation reported by several researchers involves correlation between upregulation of GADD45 and GADD153 and apoptotic induction in actively dividing cells [46-48]. Earlier study indicates that the induction of apoptosis in mice exposed to hyperoxia was associated with the upregulation of GADD45 and GADD153 gene expressions [45]. Natural products like curcumin is reported to induce DNA damage, apoptosis by GADD153 gene in human colon cancer cell lines [48].
In this study, we show that treatment with siRNAs inhibits the expression of GADD45 and GADD153 in PC-9 cells and induce apoptosis, suggesting significant role of GADD gene family in the mechanisms of cancer prevention. Protocatechualdehyde is also one of the active components of cardamom, popular dietary spice [49]. Data from earlier studies indicate that regular consumption of medicinal herbs like cardamom enhances activities like fibrinolysis, antioxidant [50] and Natural killer (NK) cell [51] in humans. Therefore, the daily consumption of cardamom will contribute to protocatechualdehyde and protect against the risk of cancer. GADD45 and GADD153 are new targets for protocatechualdehyde in lung cancer, and may be used in lung cancer prevention and treatment in humans.
This work was supported by Manipal University, Manipal India.
Select your language of interest to view the total content in your interested language
Share This Article
Relevant Topics
Disc 16S ribosomal RNA
Disc 454 sequencing
Disc Angelman Syndrome
Disc Application of MB
Disc Auto immune Disease
Disc Biomolecular Structure and Function
Disc Cancer Genetics
Disc Causes of Down Syndrome
Disc Cell Biology Junctions
Disc Cell Biology Techniques
Disc Cell Biosicences
Disc Cell Cycle
Disc Cell Death: Apoptosis
Disc Cell Regeneration
Disc Cell synthesis
Disc Cellular Biology
Disc Cellular DNA Studies
Disc Cellular Dynamics
Disc Cellular Signalling
Disc Cellular and Molecular Biology
Disc Chip Molecular Biology
Disc Chromosomal Abnormalities
Disc Clinical Molecular Biology
Disc Clone in MB
Disc Cloning
Disc Cloning Plants
Disc Cloning Vector
Disc Cloning and its application
Disc Cloning software
Disc Computational Molecular Biology
Disc Congenial Syndromes
Disc Cystic Fibrosis
Disc DNA Replication
Disc DNA sequencing
Disc Denovo sequencing
Disc Diagnostic Molecular Biology
Disc Epigenetic modification
Disc Ethics in genetic engineering
Disc Evolutionary Genetics
Disc Fragile Syndrome
Disc Functional Genomics
Disc Gene Engineering
Disc Gene Expression and Regulation
Disc Gene Flow
Disc Gene Sequencing
Disc Gene Technology
Disc Gene chip technology
Disc Gene cloning
Disc Gene cloning (DNA cloning)
Disc Gene expression
Disc Gene mutations
Disc Gene profiling
Disc Gene splicing
Disc Gene targeting
Disc Gene variation
Disc Genetic Codon
Disc Genetic Diseases Screening
Disc Genetic Disorders
Disc Genetic Diversity
Disc Genetic Drift
Disc Genetic Mutations in Humans
Disc Genetic Probes
Disc Genetic Skin Disorders
Disc Genetic Syndromes
Disc Genetic Testing for Diseases
Disc Genetic engineering application
Disc Genetic engineering crops
Disc Genetic linkage analysis
Disc Genetically Modified Organisms
Disc Genetically engineered animals
Disc Genetically engineering foods
Disc Genome Sequencing Technique
Disc Genome engineering
Disc Green genetic engineering
Disc Hair cloning
Disc Hereditary Blood Disorders
Disc Hereditary Diseases
Disc Hereditary Disorders
Disc Hereditary Mutation
Disc Human Mutation
Disc Human cloning
Disc Human genetic engineering
Disc Inherited Diseases
Disc Insulin genetics
Disc Marine Molecular Biology
Disc Marker Assisted Breeding
Disc Mass Spectrometry Molecular Biology
Disc Maxam gilbert sequencing
Disc Metagenomics
Disc Methods and Techniques in Molecular Biology
Disc Methods in Molecular Biology
Disc Mitochiondrial Disease
Disc Molecuar System Biology
Disc Molecular Biochemistry
Disc Molecular Biology Products and Market Analysis
Disc Molecular Biology and Evolution
Disc Molecular Biology of HIV
Disc Molecular Biology of Infectious Diseases
Disc Molecular Biotechnology
Disc Molecular Cell
Disc Molecular Cell Biology
Disc Molecular Cloning
Disc Molecular Genetics
Disc Muscular Dystrophy
Disc Next generation sequencing
Disc Next generation sequencing machines
Disc Next-Generation Sequencing
Disc Nucleotide Sequencing
Disc Paired End Sequencing
Disc Patau Syndromes
Disc Plasmid vector
Disc Polymerase chain reaction (PCR)
Disc Population Genetics
Disc Prenatal Genetic Testing
Disc Pyro Sequencing
Disc RNA Splicing
Disc Recombinant DNA
Disc Recombinant Gene
Disc Resistant genes
Disc Reye Syndromes
Disc Sanger Sequencing
Disc Selective breeding
Disc Sequencing primers
Disc Shotgun sequencing
Disc Sickel Cell Anemia
Disc Somatic cell nuclear transfer
Disc Stem Cell Biology
Disc Structural Molecular Biology
Disc Tay-Sachs
Disc Trans-Genesis
Disc Transcriptome sequencing
Disc Transporter gene
Disc cDNA library
Recommended Journals
Disc Sequencing & Applications Journal
Disc Genetic Engineering Journal
Disc Cloning & Transgenesis Journal
Disc Gene Technology Journal
Disc Genetic Syndromes & Gene Therapy Journal
Disc Hereditary Genetics: Current Research Journal
Disc Cellular and Molecular Biology Journal
  View More»
Recommended Conferences

Neurorehabilitation Conference
July 21-22, 2016 Brisbane, Australia

Disc  5th Alzheimer’s disease and Dementia Conference
September 29-October 01, 2016 London, UK
View More»
Article Tools
Disc Export citation
Disc Share/Blog this article
Article usage
  Total views: 11185
  [From(publication date):
October-2013 - Jun 30, 2016]
  Breakdown by view type
  HTML page views : 7451
  PDF downloads :3734

Post your comment

captcha   Reload  Can't read the image? click here to refresh

OMICS International Journals
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
OMICS International Conferences 2016-17
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

1-702-714-7001Extn: 9037

Business & Management Journals


1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

1-702-714-7001Extn: 9039

Materials Science Journals

Rachle Green

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

1-702-714-7001 Extn: 9042

© 2008-2016 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version