alexa HS3ST3B1 is a Novel Regulator of TGF-Beta Mediated EMT and Regulated by Mir-218 in Non-Small Cell Lung Cancer | Open Access Journals
ISSN: 2167-7700
Chemotherapy: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

HS3ST3B1 is a Novel Regulator of TGF-Beta Mediated EMT and Regulated by Mir-218 in Non-Small Cell Lung Cancer

Zengli Zhang1, Hanyi Jiang2, Hui Li2, Yan Li2, Liyun Miao2, Hongping Xia3, Minke Shi4, Yongsheng Wang2 and Minhua Shi1*

1Department of Respiratory Diseases, The Second Affiliated Hospital of Soochow University, Suzhou, P.R China

2Department of Respiratory Medicine, Nanjing Drum Tower Hospital Affiliated to Medical School of Nanjing university, Nanjing, P.R China

3Department of Pathology and Central Laboratory, Sir Run Run Shaw Hospital Affiliated to Nanjing Medical University, Nanjing, P.R China

4Department of Thoracic Surgery, Drum Tower Hospital Affiliated to Medical School of Nanjing University, Nanjing, P.R China

*Corresponding Author:
Minhua Shi
Department of Respiratory Diseases
The Second Affiliated Hospital of Soochow University
Suzhou, P.R China
Tel: 86-0512-68280621
E-mail: 2034273919@qq.com

Received date: January 11, 2017; Accepted date: February 04, 2017; Published date: February 08, 2017

Citation: Zhang Z, Jiang H, Li H, Li Y, Miao L, et al. (2017) HS3ST3B1 is a Novel Regulator of TGF-Beta Mediated EMT and Regulated by Mir-218 in Non-Small Cell Lung Cancer. Chemo Open Access 6:224. doi: 10.4172/2167-7700.1000224

Copyright: © 2017 Zhang Z, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Chemotherapy: Open Access

Abstract

Lung cancer is the leading cause of cancer-related death worldwide. Overall survival of all stages is unsatisfactory due to high metastasis and recurrence rates. Recent studies indicated that epithelial-to-mesenchymal transition (EMT) is involved in the progression and metastasis in cancer. Some reports also indicate that HS3ST3B1 is involved in angiogenesis and the proliferation of cancer cells. However, its role in non-small cell lung cancer (NSCLC) is not well known. In this study, we found that HS3ST3B1 was significantly up-regulated in NSCLC tissues compared with matched normal tissues (P=0.02). Its expression was also up-regulated in mesenchymal phenotype of NSCLC cell lines compared with epithelial phenotype (P<0.05). When we used TGF-β to induce the epithelial phenotype to mesenchymal phenotype, it was up-regulated compared with previous epithelial cell lines. Also, when it was knocked-down by specific siRNA in the mesenchymal phenotype, mesenchymal phenotype transformed to the epithelial phenotype. Moreover, we also found that it can be targeted by miR-218 in NSCLC. These findings indicate that HS3ST3B1 is a novel regulator of TGF-beta-mediated EMT and is regulated by miR-218 in NSCLC.

Keywords

HS3ST3B1; TGF-β; EMT, miR-218; NSCLC

Introduction

Lung cancer remains the top cause of cancer related death worldwide [1]. Patients with non-small cell lung cancer (NSCLC), representing approximately 80-85%, still have a dismay 5-year survival rate of 10-15% for all stages [2]. Most patients are inoperable and have metastasis either in nearby regional lymph nodes or distant sites at the time of diagnosis. When they have metastasis, survival time becomes even shorter compared with patients without any metastasis, ranging from 8-10 months [3]. Therefore, there is an urgent need to unravel the molecular mechanism leading to invasion and metastasis in NSCLC. Such endeavor will facilitate the development of advanced therapeutic treatments to improve the clinical outcome of NSCLC.

Activation of migration, invasion and metastasis is a crucial characteristic of cancer as one of the hallmark capabilities of malignancy [4]. Metastasis is one of the major causes of cancer recurrence and tumor-related death [5,6]. Recent studies investigating metastasis mechanisms indicated that epithelial to mesenchymal transition (EMT) was an important step during tumor progression [7]. TGF-β signaling has been shown to play a critical role in EMT. In fact, adding TGF-β to epithelial cells in culture is a convenient way to induce EMT in various epithelial cells, including in NSCLC cell lines [8]. Thus, to understand the involvement of EMT in NSCLC is crucial to unpack the myth of metastasis in NSCLC.

Heparan sulfate D-glucosamine 3-O-sulfotransferase 3B1 (HS3ST3B1) participates in the biosynthetic steps of heparan sulfate (HS) and found to target VEGF in acute myeloid leukemia (AML) cells thus contributing the angiogenesis and proliferation of AML cells [9,10]. However, the role of HS3ST3B1 in NSCLC has never been reported. In this study, we found that HS3ST3B1 was significantly up-regulated in tumors compared with matched normal tissues. Its expression was also up-regulated in mesenchymal phenotype NSCLC cells lines and when it was knockdown by siRNA, mesenchymal phenotype transformed to epithelial phenotype. Moreover, we also found it can be regulated by miR-218 in NSCLC. Thus, HS3ST3B1 is a novel regulator of TGF-beta mediated EMT and regulated by miR-218 in NSCLC.

Materials and methods

Antibodies and reagents

All antibodies were bought from Cell Signaling Technology (CST, USA). Recombinant human TGF-β was purchased from Peprotech (Rochy Hill, NJ). Other reagents were purchased from Sigma–Aldrich (St. Louis, MO), unless specifically indicated.

Cell lines, cell culture and tumors

The human NSCLC cell lines HCC827(#CRL-2868), CALU6(# HTB-56), H460(#HTB-177), H1975(#CRL-5908), A549(#CCL-185), and H358(#CRL-5807) were purchased from the American Type Culture Collection ((Manassas, VA) and cultured in RPMI-1640 medium (Invitrogen, CA) with 10% FBS and 100 U/mL penicillin/ streptomycin (Sigma, St Louis, MO). The NSCLC tumors and matched normal tissues were obtained from and kept in the Department of General Surgery, Drum Tower Hospital, Affiliated to the Medical School of Nanjing University. Informed consent was obtained from patients and this study was approved by the ethics committee of the Medical School of Nanjing University.

Real-time quantitative reverse transcription PCR

Total RNA from NSCLC tissue samples or matched normal tissues was extracted using TRIzol reagent (Invitrogen, CA). The concentration of isolated total RNA was measured on a NanoDrop ND-1000 Spectrophotometer (Agilent, CA). For mRNA detection, the total RNA was reverse-transcribed using the SuperScript III First- Strand Synthesis System kit and then amplification was performed using the SsoFast™ EvaGreen® Supermix. The primers for HS3ST3B1 were 5’-TAGCGTGGTTCTGCCTTCTT-3’(F), and 5’- GACCAGGTGAAGGACTTGGA-3’(R). The primers for HPRT1 were TGACACTGGCAAAACAATGCA(F) and GGTCCTTTTCACCAGCAAGCT(R). Primers for CDH1 and VIM were 5’-AGTGGGCACAGATGGTGTGA-3’(F),5’- TAGGTGGAGTCCCAGGCGTA-3’(R) and: 5'- CCTCACCTGTGAAGTGGATGC-3’(F) 5'- CAACGGCAAAGTTCTCTTCCA-3'(R) respectively. The sequence-specific forward primers for mature miR-218 and U6 internal control were CGTTGTGCTTGATCTAACCATGT (23 bps, GC=43.49%, Tm=60.4) and 5’- CTCGCTTCGGCAGCACA-3’, respectively. HPRT1 and U6 internal control were used as endogenous controls, and fold changes were calculated via relative quantification (2-ΔCt).

Western blotting

The H1975 cells were transfected with P-miR-218 for 72 h and then washed twice with PBS and solubilized in radioimmunoprecipitation assay lysis buffer. The supernatants, which contained whole cell protein extracts, were obtained after centrifugation of the cell lysates at 12,000g for 10 min at 4ºC. The protein concentration was determined by the DC protein assay (Bio-RAD, USA). Heat-denatured protein samples (20 μg per lane) were resolved by SDS–polyacrylamide gel electrophoresis (PAGE) and transferred to an Immobilon-P membrane (Millipore, Bedford, MA). The membrane was incubated for 60 min in PBS containing 0.1% Tween 20 and 5% skim milk to block non-specific binding, followed by incubation for 1 h at room temperature with a primary antibody. The membrane was washed three times for 10 min in PBS with 0.1% Tween 20, then incubated for 1 h with a secondary antibody. The membrane was washed thoroughly in PBS containing 0.1% Tween 20, and the bound antibody was detected with the use of enhanced chemiluminescence detection reagents (Amersham Biosciences) according to the manufacturer’s instructions.

Luciferase Reporter Assay

The potential microRNAs targeting HS3ST3B1 were selected by bioinformatic analysis. The 3’-UTR sequence of HS3ST3B1, which is predicted to interact with the microRNAs, was synthesised and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI). For the reporter assay, HEK293 cells were plated onto 24-well plates and transfected with the above constructs and miR-218 mimics or mimic-controls using the Lipofectamine 3000 transfection reagent (Life Technologies, USA). A Renilla luciferase vector pRL-SV50 (Promega, Madison, WI) was also co-transfected to normalise the differences in transfection efficiency. After transfection for 48 h, cells were harvested and assayed with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI) according to the manufacturer's instructions. This experiment was performed in duplicate in three independent experiments.

Statistical analysis

Data are presented as the mean ± standard deviation (SD). The data were analysed using SPSS 12.0 Windows version software. Statistical analyses were done by analysis of variance (ANOVA) or Student’s t test. P<0.05 was considered statistically significant.

Results

HS3ST3B1 is up regulation in lung cancer tissues and cell lines and associated with EMT

Since HS3ST3B1 plays an important role in AML cell angiogenesis and proliferation, it is interesting to investigate the role of HS3ST3B1 in NSCLC. The expression of HS3ST3B1 in tumors (n=20) and matched normal tissues (n=20) and also in mesenchymal and epithelial NSCLC cell lines was compared by qRT-PCR. Interestingly, HS3ST3B1 was up-regulated in NSCLC tumors, while it was down-regulated in matched normal tissues (Figure 1A).

chemotherapy-increased-lung

Figure 1: The expression of HS3ST3B1 was increased in lung cancer and mesenchymal phenotype NSCLC cell lines; A) The gene expresson of HS3ST3B1 was significantly increased in 20 cases of NSCLCs compared with matched normal tissues tested by qRTPCR (P=0.002); B) The expression of HS3ST3B1 was up-regulated in mesenchymal phenotype of NSCLC cell lines compared with epithelial phenotype (P<0.05).

Moreover, we analyzed the expression of HS3ST3B1 in several NSCLC cell lines. To our surprise, the expression of HS3ST3B1 was higher in the mesenchymal phenotype of NSCLC compared with epithelial phenotype NSCLC (Figure 1B); the expression in both NSCLC cell lines was higher than in normal lung tissue (Figure 1B).

Thus, HS3ST3B1 may not only be involved in the progression or development of NSCLC, but could also play an important role in the EMT process and metastasis in NSCLC.

The expression of HS3ST3B1 was significantly increased in epithelial lung cancer cells with TGF-β mediated EMT

TGF-β is a convenient way to induce the EMT process in tumors; thus, to investigate the significance of HS3ST3B1 in the EMT process of NSCLC, we firstly induced epithelial NSCLC cell lines (A549 and HCC827) to mesenchymal phenotype by TGF-β. After 96 hours of culturing with TGF-β, we observed the morphologic change of appearance of A549 and HCC827. Apparently, the A549 and HCC827 cells lost the close connection with each other and developed spindle-shaped morphology under microscope (Figure 2A and 2B). The loss of E-cadherin is considered to be a fundamental event in EMT; thus, we next analyzed the gene coding E-cadherin and mesenchymal phenotype biomarker-Vimentin in TGF-β cultured A549 and HCC827 cells. Not surprisingly, the gene coding E-cadherin, CDH1, was down-regulated while the gene coding Vimentin, VIM, was up-regulated (Figue 2B), indicating that TGF-β successfully transformed A549 and HCC827 from epithelial phenotype to mesenchymal phenotype. More interestingly, when we analyzed the expression of HS3ST3B1 again in the mesenchymal phenotype induced by TGF-β, we found that it was significantly up-regulated. All of these results suggested that HS3ST3B1 may involve in the process of EMT in NSCLC.

chemotherapy-induced-EMT

Figure 2: HS3ST3B1 was increased in TGF-β induced EMT process; A) Both A549 and HCC827 are epithelial phenotype of NSCLC. After inducing by TGF-β, both cell lines transformed to mesenchymal phenotype morphologically; B) CDH1 is the gene of E-cadherin and VIM is the gene of Vimentin, both of them are EMT biomarkers. CDH1, the epithelial biomarker, was increased in A549 and HCC827. And VIM, the mesenchymal biomarker, was up-regulated in TGF-β induced A549 and HCC827. When epithelial phenotype of A549 and HCC827 were transformed to mesenchymal phenotypes induced by TGF-β, the expression of HS3ST3B1 was significantly increased.

Knockdown of HS3ST3B1 reverses the mesenchymal phenotype of lung cancer cells

We have demonstrated that HS3ST3B1 was up-regulated when NSCLC transformed from the epithelial phenotype to the mesenchymal phenotype; therefore, it is interesting to investigate whether the knockdown of HS3ST3B1 can reverse the EMT process. First, we selected two mesenchymal phenotypes: NSCLC-H460 and H1975. Both of them appeared to have mesenchymal morphology. Then, we used siRNA to knockdown the expression of HS3ST3B1; to our surprise, the cells lost their spindle-shaped appearance compared with siRNA control transfection (Figure 3A). More importantly, we analyzed the epithelial and mesenchymal marker-related genes and found that when HS3ST3B1 was knocked-down, CDH1 was up-regulated and VIM was down-regulated (Figure 3B). These results indicated that the expression of HS3ST3B1 was essential to maintain the mesenchymal phenotype in NSCLC cells, knockdown of HS3ST3B1 can induce the mesenchymal phenotype transform to epithelial phenotype in NSCLC. Together with previous results, we confirmed that HS3ST3B1 may be a novel regulator of EMT in NSCLC.

chemotherapy-mesenchymal-epithelial

Figure 3: Silence of HS3ST3B1 induced mesenchymal-epithelial transition in the mesenchymal phenotype of NSCLC cell lines; A) Morphological change from an elongated fibroblastic phenotype of H460 and H1975 to an epithelial cobblestone phenotype when HS3ST3B1 was suppressed by siRNA; B) Expression of EMT related genes, CDH1 and VIM in H460 and H1975 cells stably transfected with shControl or shHS3ST3B1.

The expression of HS3ST3B1 was regulated by miR-218 in lung cancer cells

Since HS3ST3B1 plays an important role in NSCLC EMT process, it is interesting to investigate regulation of the expression of HS3ST3B1. Previous studies have suggested that at least one-third of human genes are estimated to be miRNA targets, so the regulation mediated by miRNA at the post-transcriptional level is pervasive in animals [11]. To identify the potential post-transcriptional regulation of HS3ST3B1 by miRNAs, we used miRNA target prediction tools-TargetScan/ TargertScanS. A significant expression correlation was observed between HS3ST3B1 and miR-218 (Figure 4A), suggesting that HS3ST3B1 may be regulated by miR-218. To validate whether miR-218 directly recognizes the 3′-UTRs of HS3ST3B1 mRNA, we cloned the 3’UTR of HS3ST3B1 to the pGL3 luciferase reporter gene to generate pGL3- HS3ST3B1-3’UTR or pGL3-control vectors. The vectors were then co-transfected with miR-218 mimics or mimic controls into HEK293 cells. A renilla luciferase vector (pRL-TK) was used to normalize differences in transfection efficiency. Luciferase activity in cells co-transfected with miR-218 mimics and pGL3- HS3ST3B1-3’UTR vectors was decreased when compared with the control (Figure 4B). Next, we further detected the protein expression of HS3ST3B1 in cells after transfection with miR-218 mimics or mimic controls. The results showed that the over-expression of miR-218 decreased the expression of HS3ST3B1 (Figure 4C and 4D). These data suggest that the expression of HS3ST3B1 can be regulated by miR-218 in NSCLC.

chemotherapy-functional-downstream

Figure 4: HS3ST3B1 was identified as a functional downstream targets of miR-218; A) Bioinformatics was used to predict the binding sites between miR-218 and HS3ST3B1 3’UTR-wt and mutation; B) qRT-PCR was applied to test the expression of miR-218 relative to U6 after the transfection of miR-218 mimics and mimic control; C) Total cell lysates were extracted from p-miR- 218 or p-miR-control vector transfected cells then analysed by Western blot; D) The relative luciferase activity of cells co-transfection with p-miR-218 or p-miR-control vector and pGL3- HS3ST3B1-3’UTR-wt or mutation vector.

Discussion

EMT in cancer is a highly coordinated process by which tumor cells acquire new characters, such as the expression of mesenchymal markers and loss of epithelial markers, and undergo profound morphogenetic changes [12]. It has been extensively studied and demonstrated to play an important role in cancer progression, maintenance of stemness and chemotherapeutic drug resistance [13]. The EMT process can be controlled by intrinsic oncogenic activation such as K-ras mutation or HER2 overexpression [14,15]. Also, this process can be triggered by external stimuli such as Wnt, TGF-β, Hedgehog, epidermal growth factor, hepatocyte growth factor and cytokines like IL-6 [16]. In this study, we first found that HS3ST3B1 is up-regulated in NSCLC, indicating that it might be involved in the development or progression of NSCLC. Next, we found that it was also up-regulated in mesenchymal phenotype cell lines, suggesting that it might promote the EMT process.

Next, we used TGF-β to induce epithelial phenotype NSCLC cell lines into the mesenchymal phenotype. The morphology change to spindle-shaped indicated that the cells had undergone the EMT process, and the CDH1 down-regulation and VIM up-regulation suggested that they had successfully transformed to the mesenchymal phenotype molecularly. When they became mesenchymal tumor cells, and consistently with previous results, we found that even in epithelial cancer cells induced by TGF-β into mesenchymal cells, HS3ST3B1 was up-regulated, confirming that it might be a novel regulator of EMT process in NSCLC.

HS3ST3B1 participates in the biosynthetic steps of HS and has been found to target VEGF in acute myeloid leukaemia (AML) cells, thus contributing to the angiogenesis and proliferation of AML cells [10]. It has also been reported to effectively inhibited HBV replication and viral protein expression in vitro [16]. However, it has never been reported in NSCLC. In our study, we first found that it was up-regulated in NSCLC, and it can also regulate the EMT process of NSCLC, confirming that it might be associated with the progression and metastasis of NSCLC. To the best of our knowledge, this is the first report to associate HS3ST3B1 with EMT in cancer. These observations need to be warranted in more research. The shortcoming is the absence of a mechanism by which HS3ST3B1 regulates the EMT process.

Moreover, about 1/3 of all genes have been demonstrated to be regulated by miRNAs in mammals [17,18]. Whether HS3ST3B can be regulated by miRNA in NSCLC is an interesting question. To answer this question, we first used computational software to predict which miRNA target HS3ST3B based on the partial or complete complementarity between miRNAs and mRNA transcripts. Also, we found that miR-218 may target HS3ST3B in cells. Then, we established the luciferase report system and demonstrated that miR-218 not only targets the 3’-UTR of HS3ST3B by computational prediction tools and also regulates HS3ST3B in cells. The forced expression of miR-218 can down-regulate the expression of HS3ST3B, confirming its transcriptional regulation of HS3ST3B in cancer cells. MiR-218 was found to be deleted or down-regulated in squamous lung cancer and hepatocellular carcinoma [19,20]. Also, it has also been demonstrated to target Rictor in cervical and oral cancer cells to modulate tumour growth and chemosensitivity [21,22]. In our study, it may target HS3ST3 and be involved in the EMT process of NSCLC.

Conclusion

We found that HS3ST3B can regulate the TGF-β-induced EMT process, and it can also be regulated by miR-218 in NSCLC. However, through which mechanism it regulates the EMT process warrants future research.

Acknowledgements

This study was supported by Grants from the National Natural Science Foundation of China (81301882, 81272610)and the Fundamental Research Funds for the Central Universities (20620140732, 2062014118), and the technology and social development Funds Of Suzhou City (SYS201467).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 53
  • [From(publication date):
    March-2016 - Mar 23, 2017]
  • Breakdown by view type
  • HTML page views : 35
  • PDF downloads :18
 
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

OMICS International Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
OMICS International Conferences 2016-17
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2016 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version