alexa Molecular Identification of Some Ghanaian Mushrooms Using Internal Transcribed Spacer Regions | Open Access Journals
ISSN: 2168-9547
Molecular Biology: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Molecular Identification of Some Ghanaian Mushrooms Using Internal Transcribed Spacer Regions

Theresa Appiah1, Christian Agyare1* and Yinggang Luo2

1Microbiology Section, Department of Pharmaceutics, Faculty of Pharmacy and Pharmaceutical Sciences, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana

2Center for Natural Products Research, Chengdu Institute of Biology, Chinese Academy of Sciences, China

*Corresponding Author:
Dr. C Agyare
Microbiology Section, Department of Pharmaceutics
Faculty of Pharmacy and Pharmaceutical Sciences
Kwame Nkrumah University of Science and Technology
Kumasi, Ghana
Tel: +233- 246369803
E-mail: cagyare.pharm@knust.edu.gh

Received date: May 09, 2017; Accepted date: May 26, 2017; Published date: June 06, 2017

Citation: Appiah T, Agyare C, Luo Y (2017) Molecular Identification of Some Ghanaian Mushrooms Using Internal Transcribed Spacer Regions. Mol Biol 6:191. doi:10.4172/2168-9547.1000191

Copyright: © 2017 Appiah T, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Molecular Biology: Open Access

Abstract

Mushooms have recently attracted attention and are exploited for food and medicinal purposes. Accurate identification of mushrooms is key in utilizing them for the benefit of humans. However, morphological identification of mushrooms is time consuming, tedious and may be prone to error. DNA markers are quick and reliable tools that are useful in mushroom taxonomy. Thus this study confirmed the identity of six Ghanaian mushrooms using the internal transcribed spacer (ITS) sequences. The ribosomal DNA-ITS fragments of genomic DNA of six wild mushrooms were amplified using ITS1 and ITS4 primers. The amplicons were sequenced and data assembled and analyzed using Bio Edit. Basic Local Alignment Search Tool (BLAST) search was carried out using the National Center for Biotechnology Information (NCBI) database. The data obtained from the sequence alignment were used to plot a phylogenetic tree using the Neighbor-Joining method in Molecular Evolutionary Genetics Analysis (MEGA). The nucleotide sequences of the six mushrooms blasted against sequences from GenBank data base revealed that Volvariella volvacea, Trametes elegans, Trametes gibbosa, Ganoderma lucidum, Pleurotus ostreatus and Schizophyllum commune matched 100, 97, 99, 98, 98 and 100% Volvariella volvacea strain OE-55, Trametes elegans isolate BCC23750, Trametes gibbosa strain 391, Ganoderma lucidum strain IMSNU32114, Pleurotus ostreatus strain H-8 and Schizophyllum commune strain SCSIO, with accession numbers KC142119, FJ372691.1, KC525203.1, AF214467.1, JQ837478.1 and KX258807.1, respectively. Phylogenetic tree showed close relationship between T. elegans and T. gibbosa, V. volvacea and P. ostreatus. Molecular identification of all six mushrooms corresponded to morphological identification up to species level. This is the first report on identification of these Ghanaian mushrooms using the ITS sequences.

Keywords

Mushrooms; Internal transcribed spacer (ITS); Molecular identification; Ghana

Introduction

Mushrooms are macro fungi with conscipcious fruiting bodies that can be either epigenous or hypogenous, large enough to be seen with the naked eye and to be picked by hand [1-3]. The macrofungi include the puffballs, the bracket fungi, the gilled fungi and the stinkhorns [4]. The mushrooms can be categorised into two major phylum, Ascomycota and Basidiomycota and are either edible, non-edible or poisonous [5,6]. Mushrooms are commonly found all over the world and every single mushroom has its specific habitat in which it thrives [7].

Apart from their significant role in the ecosystem as decomposers and recyclers, mushrooms possess several biological activities such as antioxidant, antibacterial, antifungal, antiviral, anti- parasitic, anti-diabetic, anticoagulant, anti-inflammatory, anti-proliferative, anticancer, hepato- protective and insecticidal properties [8-10]. Again, mushrooms have great economical and nutritional value with nutrient contents such as fibers, proteins, vitamins and minerals [9,11]. Thus, it is extremely important that proper knowledge on mushroom identification be established for its effective exploitation to the benefits of mankind.

The usual methods of mushroom identification include the use of morphological characteristics of the fruit body, culturing on various media to differentiate the mycelia of different species and the use of selective inhibitors or indicator substrates [12-14]. Though these methods of identification are routinely used, they are difficult, time consuming and may lack accuracy in differentiating closely related species [15,16]. However, molecular identification procedures have proved to be fast, specific have proved to be fast, specific and sensitive for the identification of the genetic relationships among mushrooms [17,18].

Molecular methods used in the identification of mushrooms include rDNA-ITS region and sensitive for the identification of the genetic relationships among mushrooms [17,18].sequence analysis, internal transcribed spacer-restriction fragment length polymorphism (ITS-RFLP) [19,20,21], rapid amplified polymorphic DNA (RAPD) and matrix assisted laser desorption/ionization time of flight (MALDITOF) mass spectrometry [22, 23].

Nuclear ribosomal DNA (rDNA), especially the internal transcribed spacer (ITS) regions have been excellent targets for studying genetic relationship of mushrooms [24]. This is because the ITS regions are highly conserved among intraspecies but variable between interspecies and are very easy to amplify even from small quantities of DNA [25-27].

The mushrooms studied have been reported to exhibit activity such as antimicrobial, antioxidant, antitumour and anti-inflammatory activities. For instance, Awala and Oyetayo [28] and Aina et al. [29] reported the antiradical and antimicrobial activity of Trametes elegans. Trametes gibbosa has been revealed to exhibit antibacterial, antioxidant and antiviral activities [30-32]. Ganoderma lucidum is known to possess medicinal effects and have been used as traditional medicines in many Asian countries [33]. It is known to have many activity such as antimicrobial, antiviral, antioxidant and antitumour [34-37] properties. Pleurotus ostreatus is rich in dietary fibres, proteins, vitamins and minerals [38,39]. There have been researches carried out, which documents its antimicrobial, antioxidant and antitumor properties [40-44]. Kabuyi et al. [45] reported the antioxidant, antitumor, anticancer and immunomodulating properties of Schizophyllum commune. Volvariella Volvacea, the fourth most cultivated edible mushroom in the world due to its delicious flavour, texture, nutritional attributes and medicinal properties antioxidant, hepatoprotective, anticancer and immunomodulatory [38,46-51] activities.

Though mushrooms especially the edible ones are not entirely new food item on the table of Ghanaians, it was at a point relegated to the background as food for rural folks. Until recently, mushrooms were not cultivated crops as they grew on their own in mostly forest areas and were harvested through hand pick by farmers. They are identified based on phenotypic features such as the colour of their basidiocarp, most of which are closely related and therefore require high level of expertise and experience. Since morphologically, genetically different and similar mushroom species may look alike, the identity of mushrooms need to be confirmed using other approaches instead of the traditional methods of identification. Thus this study sought to use the internal transcribed spacer-polymerase chain reaction (ITS-PCR) to investigate the molecular variability of some mushroom species in Ghana in order to obtain good identification knowledge to aid in mushroom taxonomy, as well as the commercialization of mushrooms.

Materials and Methods

Samples of six different wild mushrooms were collected farms and Forests in Ayeduase (latitude 6°40’33N, longitude 1°33’36W, altitude 252 m) and Jachie Pramso (latitude 6°36’N, longitude 1°44’W, altitude 266 m) in the Ashanti Region, and Abura Kwaman (latitude 5˚05’N to 5˚25N, longitude 1˚5’W to 1˚20’W, altitude 75 m) in the Central Region of Ghana. The mushrooms were collected from June to November, 2012 from their natural habitats such as hard wood trees including Mangifera indica, Delonix regia, and other decaying hard woods. The habitat, morphological features and any other phenotypic parameters were noted while the mushrooms were still fresh. Where applicable, colour of spore prints were noted.

The samples were initially compared with descriptions in books and other literature to aid classification and were later described for morphological characters such as colour, size, texture shape and margin of fruit body, other features such as odour, stipe and stipe length, pileus length, gill attachment and spacing were considered.

The samples were morphologically characterized as follows: Schizophyllum commune, Trametes gibbosa, Trametes elegans, Volvariella volvacea, Pleurotus ostreatus and Ganoderma lucidium, [52,53]. These Basidiomycetes were authenticated by Mr. A. K. Apetorgbor, a mycologist in the Department of Theoretical and Applied Biology, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana.

DNA extraction

Dried fruit bodies of the mushroom samples (oven dried at 30oC) were used and DNA was extracted using Transgen DNA extraction kit (Tiangen Biotech Co. Ltd, Beijing, China) following the manufacturer’s protocol with slight modification. Briefly, ten milligrams (10 mg) of powdered fruit bodies was transferred into Eppendorf tubes. Five hundred microlitres of extraction buffer (100 mM Tris-HCl [pH = 8.0], 10 mM EDTA; 0.7 M NaCl; 1% cetyltrimethylammonium bromide (CTAB) (w/v); and 1% 2-mercaptoethanol) was added and sonicated for 15 min.

This was followed by heating at 100oC for 5 min and incubated immediately on ice for 4 min. The heating and incubating on ice was repeated five times in order to extract the DNA from the mushroom samples. DNA was then purified using Transgen DNA purification kit (Tiangen Biotech Co. Ltd, Beijing, China) following the manufacturer’s protocol.

PCR amplification of the ITS region

Two universal primers, ITS1 (5’-TCC GTA GGT GAA CCT GCG G-3’), forward primer and ITS- 4 (5’-TCC TCC GCT TAT TGATAT GC-3’), reverse primer were used for the amplification of the ITS regions of the mushrooms [30]. The PCR amplifications were performed in a total reaction volume of 25 μL composed of 0.25 μL TransTaqTM Hifi DNA Polymerase, 15.5 μL distilled water, 2.5 μL TransTaq Hifi Buffer I (10X), 2.0 μL high pure quality TransTaq dNTPs (2.5 mM), 1 μL ITS1 (0.2 μM) and ITS4 (0.2 μM), and 3 μL template DNA. The PCR tubes were placed in a thermal cycler for amplification for 2 hrs under the following conditions: an initial denaturation of 3 min at 94°C followed by 35 cycles of 45 sec at 94ºC, an annealing temperature at 55°C for 45 sec, extension at 72ºC for 1 min, and a final extension at 72ºC for 10 min. DNA fragments from agarose gel were purified using TIANamp DNA purification kit (Tiangen Biotech (Beijing) Co. Ltd, China) following the manufacturer’s protocol.

Sequencing and analysis of ITS region

The PCR products of ITS amplified regions were cloned using pGEM®-T Easy Vector Ligation kit (Tiangen Biotech Co. Ltd, Beijing, China) and sequenced with the same primer pair used in the PCR reactions (ITS1 and ITS4). The cloned polymerase chain reaction (PCR) products were sequenced using an ABI3100 automated DNAsequencing system by Tsingke Company Ltd, Chengdu, China.

The sequence data were assembled and analyzed using BioEdit version 7.2.5 and aligned with ClustalW. Nucleotide sequence comparisons were performed by using Basic Local Alignment Search Tool (BLAST) network services against the National Center for Biotechnology Information (NCBI) database.

Phylogenetic tree was constructed using the Neighbor-Joining method [54]. The optimal tree was drawn with the sum of branch length equal to 4.0691 (shown next to the branches). The evolutionary distances were computed using the Maximum Composite Likelihood method. Evolutionary analysis was conducted in Molecular Evolutionary Genetics Analysis (MEGA) version 7.0.21 [55].

Results

The PCR amplification products (Figure 1) showed that S. commune and G. lucidum gave about 600 bp amplified band each, T. gibbosa and P. ostreatus showed 400 bp amplified band each while V. volvacea and T. elegans gave 500 and 300 bp amplified bands, respectively. These PCR products were gel purified, run in 1% agarose gel, and processed for nucleotide sequencing.

molecular-biology-amplified-products

Figure 1: Agarose gel electrophoresis of PCR amplified products of ITS regions of V. volvacea, T. elegans, S. commune, P. ostreatus, G. lucidum and T. gibbosa. M=DNA marker (100 bp); 1=S. commune; 2=G. lucidum; 3=T. gibbosa; 4=V. volvacea; 5=T. elegans and 6=P. ostreatus

molecular-biology-Phylogenetic-tree

Figure 2: Phylogenetic tree depicting relationship among mushroom samples.

The partial nucleotide sequences (Table 2) of the six (6) mushroom samples were obtained and analyzed using BioEdit and and aligned with ClustalW. Basic Local Alignment Search Tool (BLAST) search program (National Center for Biotechnology Information (NCBI) site) against the whole GenBank data base of nucleotide sequences were used for identification.

The BLAST results (Table 1) obtained by searching with partial nucleotide sequences (Table 2) at the GenBank data base resulted in the following: V. volvacea [Family: Pluteaceae; % identity 100 (KC142119.1)], T. elegans [Family: Polyporaceae; % identity 97 (FJ372691.1)], S. commune [Family: Schizophyllaceae; % identity 100 (KX258807.1)], P. ostreatus [Family: Pleurotaceae; % identity 98 (JQ837478.1)], G. lucidum [Family: Ganodermataceae; % identity 98 (AF214467.1)] and T. gibbosa [Family: Polyporaceae, % identity 99 (KC525203.1)].

Sample Percentage  (%) identity Accession number Identified name of sample
1 100 KX258807.1 Schizophyllum commune strain SCSIO
2 98 AF214467.1 Ganoderma lucidum strain IMSNU32114
3 99 KC525203.1 Trametes gibbosa strain 391
4 100 KC142119.1 Volvariella volvacea strain OE-55
5 97 FJ372691.1 Trametes elegans isolate BCC23750
6 98 JQ837478.1 Pleurotus ostreatus strain H-8

Table 1: Summary of BLAST results.

Sample number Sequences
  1 CAAATTAGGAACAAACAAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCCAAAGCCTTCACGGGCGGCGGTTGACTACGTCTACCTCACACCTTAAAGTATGTTAACGAATGTAATCATGGTCTTGACAGACCCTAAAAAGTTAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATACCATCAACCCTCTTTTGACTTCGGTCTCGAGAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTTAAATGTATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATAATTTCTACGTCGTTGACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCTTGACCGAGACTAGCGACTTGTGCGCTAACTTT
  2 TTTTTCAGTAGTTTAAGACATGCAAATCGTTGTTCCCAACGTCCTTTTTTAATTAATATTTTAATATTAATGGGATTAGGGGATAAGGTGTAGAGGTGAGTATGTTAAATAAGATACCCTATAGTCTTCTTAGCTAGGGGATATAAACTAAAGGAAAATTTCTGCTATAGGATTCTATTTAATTTGATTAGGTAGTTGATAGGGTAACGGCCTACCAAGCCAACGATCGAAAGTCAAGTTTGAAAGAACCTCTGGCCACATTGGGGATTAAATCTCCCAAGTAGTAAACACACTACCAGCAGTCGAGAATATTAGTCAATGCTCGTAAGAGTGAACTAGCTAACTGAAATCATAGTATTTTTTCAAATGCATGATGTCGTAAGGGAAAATAATGATAATACCTTACTATGAGTGTCGTCCAAATCTGGTGCCAGAAGACTCGGTAAGACCAGAGACGCAAACGTTAATCATCATAAACAGGCGTAAAGGGTTTGTAGGCAGCTTTTATAAGATTATGATTGCAACAAACTAAAGGGTAATCTAAATTGAAAGCTAGAATCAAACAGAGGTTATAGTGTATAACGCCTAGAGGAGGGCTGATATCCATAGATCCTAGGCAGAATACTCAGGGCGAAGGCCACTCTCCACTAATGATTGACGCTGAGAAACGAAG
  3 TTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTCTGCGTGGGTTTCTAGCCTCCGGGTTGGGAGCATTCTGCAGGCTTATGTATACTATAAACACTTTAAAGTAACAGAATGTAAACGCGTCTAACGCATTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCATAAATCCTTGTGGAAGTATGGGCTTGGATTTGGAGGTTTGCTGGGTCCCCTGGGGTCCGGCTCCTCTCGAACGCATTAGCTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTATCTACGCTGTGACCGTGAAGTGTTTGGCGAGCTTCCAACCGTCTTTTTTGGACAACCTTATGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
 4 GATCATTACAGAATCGAACGCGGGTCGGGCTGATTGCTGGCTCCTCGGAGCAGGTGACGCCCTCCCCGACGCCTTCCATTCTCCACGTCCCCACCTGTGCACCTTCTGTAGGCCGTGAAGCCGCCTCGTTCGGCTCCCTCGGCTCTACGAGATCTTTTGTACACCCTTGAGAAAAACGTGTTGCAGAGTGTTCTTGTACGACCGGGGACCCCTCGTCGGCCCCATAGACATACCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT
  5 GAAGGATCATTAACGAGTTCTGAAACGGGTTGTAGCTGGCCTTCCGGGGCATGTGCACACCCTGCTCATCCACTCTACACCTGTGCACTCACTGTAGGTTGGCGTGGGCTTCCTTCACGGGAAGCATTCTGCCGGCCTATGTACACTACAAACACTATAAAGTAACAGAATGTATTCGCGTCTAACGCATCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCTATAAATCTTTGTGGTTTATGGGCTTGGACTTGGAGGCTTGCCGGCCTCAATGGTCGGCTCCTCTCGAATGCATTAGCTTGATTCCGTGCGGATCAGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGCGTTTGGCGAGCTTCTAACCGTCCCGTTGGGACAATTTATTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA 
  6 AGTCTTCCCAACCACCTGTGAACTTTTGATAGACAGTGAAGTCGTCTCTCAAGTCGTCAGACTTGGTTGCTGGGATTTAAACGTCTCGGTGTGACTACGCAGTCTATTTCTTACACACCCCAAATGTATGTCTACGAATGTCATTTAATGGGCCTTGTGCCTTTAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATAAATTCTCAAACTCACTTTGGTTTCTTTCCAATTGTGATGTTTGGATTGTTGGGGGCTGCTGGCCTTGACAGGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGCATGATGTGATAATTATCACCATCAATAGCACGCATGAATAGAGTCCAGCTCTCTAATCGTCCGCAAGGACAATTTGACAATTTGACCTCAAATCAGGTAGGA

Table 2: Partial nucleotide sequences of V. volvacea, T. elegans, S. commune, P. ostreatus, G. lucidum and T. gibbosa.

Phylogenetic tree (Figure 2) revealed a close relationship between T. elegans and T. gibbosa. A close relationship was also observed between V. volvacea and P. ostreatus. S. commune showed close affinity to T. elegans, T. gibbosa, V. volvacea and P. ostreatus, while G. lucidum showed distant relationship with T. elegans, T. gibbosa, V. volvacea and P. ostreatus.

Discussion

Correct identification procedure of medicinal mushrooms is required for quality control of functional health-aid preparations as well as nutritional supplements [56]. The ITS region of nuclear ribosomal DNA, including ITS1, ITS2 and ITS4, has been used to determine variability in fungi at the species and sub-species levels [57-60]. Though study on the molecular identification of Ghanaian mushrooms using the ITS region is limited, the findings in this study is in accordance with the study by Das et al. [8] and Raju et al. [61] who used the ITS Region to confirm the identity of Volvariella volvacea obtained from Kalyani and Tamil Nadu, different parts of India, respectively. Olusegun confirmed the identity of T. elegans from Nigeria with 98% similarity to T. elegans, accession number JN164921.1 from GenBank repository. Cui et al. [62,63] used the ITS region to confirm the identity of European Trametes gibbosa. Bankole and Adekunle used the ITS region to study the biodiversity of G. lucidum and P. ostreatus from Nigeria. Though from GenBank data base, the species form Nigeria corresponded to different G. lucidum and P. ostreatus compared to those identified in Ghana. The phylogenetic tree constructed revealed a close relationship between T. elegans and T. gibbosa, which formed a single clade. This corresponds to the study by Tomšovský et al. [64,65] who revealed that all Trametes species form a single clade (Figure 2).

The identity of these Ghanaian mushrooms (V. volvacea, T. elegans, S. commune, P. ostreatus, G. lucidum and T. gibbosa) is being confirmed for the first time using the ITS region of the rDNA. The present study possibly suggests that GenBank data base for mushroom is not sufficiently rich in mushrooms from Ghana. However, nucleotide sequences of these mushroom samples may be relevant to GenBank data base for further exploration in the field. The nucleotide sequences, together with morphological identification could also help both farmers and researchers in choosing the right mushrooms both for commercial and research purposes. Again the molecular identification method used could serve as a guide for identifying other Ghanaian mushrooms.

Conclusion

All six mushrooms could be identified up to species level from the available GenBank data base. Molecular identification of the mushroom samples corresponded to morphological identification of the samples up to species level. The evolutionary relationship among these mushrooms could aid in commercialization and investigations of bioactive compounds from these mushrooms.

Acknowledgement

We wish to thank the Organization for Women in Science for Developing Countries (OWSD) and the Mwalimu Nyerere African Union Scholarship for TA.

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Recommended Conferences

Article Usage

  • Total views: 79
  • [From(publication date):
    July-2017 - Aug 19, 2017]
  • Breakdown by view type
  • HTML page views : 59
  • PDF downloads :20
 
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2017-18
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version