alexa Overexpression of Pleiotrophin Contributes to Doxorubicin Resistance of Osteosarcoma | Open Access Journals
ISSN: 2167-7700
Chemotherapy: Open Access
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Overexpression of Pleiotrophin Contributes to Doxorubicin Resistance of Osteosarcoma

Jian Li1,2, Tao Zhou1, Hao Lin1, Xiaoqiang Chen1, Shaoqian Wang1, Yongsheng Wang3 and Zongsheng Yin4*

1Anhui Medical University, Hefei, Anhui, P.R China

2Department of Orthopedics, Ma’an Shan People’s Hospital, Ma’an Shan, Anhui, P.R China

3Department of Respiratory Medicine, Nanjing Drum Tower Hospital Affiliated to Medical School of Nanjing University, Nanjing, P.R China

4Department of Orthopedics, First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P.R China

*Corresponding Author:
Zong-sheng Yin
Department of Orthopedics
First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P.R China
Tel: +86-139-5697-7198
Fax: +86-551-343-2123
E-mail: zongshenyin121@163.com

Received date: January 09, 2017; Accepted date: February 03, 2017; Published date: February 08, 2017

Citation: Li J, Zhou T, Lin H, Chen X, Wang S, et al. (2017) Overexpression of Pleiotrophin Contributes to Doxorubicin Resistance of Osteosarcoma. Chemo Open Access 6:223. doi: 10.4172/2167-7700.1000223

Copyright: © 2017 Jian L, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Chemotherapy: Open Access

Abstract

Doxorubicin (DOX) is one of the major chemotherapeutic drugs used in the treatment of human osteosarcoma (OS). However, acquisition of DOX resistancefrequently occurring in patients with OS, leads to poor survival rate of OS patients. Pleiotrophin (PTN) is a proto-oncogene overexpressed in various malignant human tumors. Studies concerning the role of PTN in OS are limited. In this study, we initially established two DOX resistant cell lines. We found that PTN expression was elevated in DOX resistant cells (HOS/DOX and MG63/DOX) compared to their parental cells; and down-regulating the PTN level by RNA interference could enhance the therapeutic efficacy of DOX to DOX resistant OS cells. In addition, PTN expression was significantly up-regulated in OS tumors compared to normal tissues; and increased PTN expression in OS was associated with inferior disease-free survival. Taken together, the results presented here suggest that PTN is a promising therapeutic target for OS treatment in future.

Keywords

Osteosarcoma; Doxorubicin resistance; Pleiotrophin; Disease free survival

Introduction

Osteosarcoma (OS), the most common primary malignancy of bone in children and adolescents, is typically treated with surgery and adjuvant chemotherapy [1,2]. Higher survival rates have been achieved since the introduction of novel chemotherapy, followed by surgical removal of the primary lesion [3,4]. However, the clinical effectiveness is still limited in the treatment of OS due to the emergence of chemoresistance [5,6]. Therefore, identification of genes contributing to chemoresistance is extremely important in predicting patient responsiveness and overcoming chemoresistance in OS patients.

Pleiotrophin (PTN), along with midkine, constitutes a two-member family of heparin binding growth factors [7]. PTN has been reported overexpressed in various malignant human tumors, as well as being involved in tumor angiogenesis and metastasis [8,9]. It regulates multiple functions including cell adhesion, cell migration and cell proliferation by activating its cell surface receptors [10-12]. However, studies concerning the role of PTN in OS are limited. High PTN expression was found in poor OS chemotherapy responders [13] and in the cell lines possessing potential metastasis [14]. Further investigation of the role of PTN in OS chemoresistance remains to be established.

In this study, we investigated the role of PTN genes in the development of DOX resistance by establishing DOX-resistant cells from HOS and MG-63 cell lines. We found the PTN level increased significantly in DOX-resistant cells comparing to their parental cell lines. By down-regulating PTN expression using RNA interference, the therapeutic efficacy of DOX increased. Moreover, the status of the PTN gene at clinical onset was also assessed in a series of OS clinical samples in order to identify the potential relationship between PTN expression and disease-free survival of OS patients. And we found that and increased PTN expression in OS was associated with inferior disease-free survival.

Materials and methods

Cell culture

The human OS cell lines HOS and MG63 were obtained from Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). Cells were cultured in RPMI 1640 medium (GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (GIBCO), 100 U/mL penicillin and 100 mg/mL streptomycin at 37ºC in a humidified 5% CO2 atmosphere.

Clinical specimens

All primary OS tissues and adjacent normal tissues were obtained from patients at the Department of Orthopedics, Ma’an shan People’s hospital, between May 2010 and January 2016. The fresh tissue samples were immediately immersed in RNAlater (Qiagen, Germany) after surgical resection, stored at 4ºC overnight and subsequently frozen in liquid nitrogen for storage at -80ºC until analysis. The tissue samples were collected and used after obtaining approval from the Ethics Committee of Ma’anshan People’s Hospital. Written informed consent was obtained from all of the patients who participated in this study according to committee’s regulations. Disease free survival was defined as the interval between date of diagnosis and first recurrence or death. The prognostic effect of PTN was evaluated using the Kaplan-Meier method and compared using the log-rank test.

Induction of doxorubicin resistance in OS cell lines

DOX-resistant cell lines (HOS/DOX and MG-63/DOX) were established in a step-wise manner by exposing their parental cell lines to gradually increasing concentration of DOX over a period of 6 months. In brief, cells were initially cultured in DMEM containing 5 nM DOX and the cells that proliferated were repeatedly sub-cultured in DMEM containing increasing concentrations of DOX over a 6 months period. The HOS/DOX and MG-63/DOX cells proliferation were maintained in DOX and the cells were incubated in DOX-free medium for at least 1 week before use.

Cell proliferation assay

Cell proliferation was measured using the CCK8 method. In brief, cells were seeded onto 96-well plates at a density of 5 × 103 cells/well. Entitled to 24 h culture, cells were treated with the indicated concentration of DOX (0, 0.625, 1.25, 2.5, 5, 10 nM), and cultured for another 48 h. At indicated time points, Cell Counting Kit-8 (CCK-8, Dojindo) was added into each well according to the manufacturer’s instructions and cultured for 4 h. Then absorbance was measured at 450 nm with a microplate reader (Molecular Devices Corp., Sunnyvale, CA, USA). The percentage cell growth inhibition for each treatment group was calculated by adjusting the untreated group to 100%. All experiments were performed in triplicate and repeated at least three times.

Quantitative real-time PCR

Total RNA was extracted using TRIZOL (Takara) and then reversetranscribed to cDNA using Prime Script Reverse Transcriptase (Takara). Quantitative real-time PCR (qRT-PCR) was performed using the ABI prism 7300-sequence detection system (Applied Biosystems, New York, USA). The following cycle parameters were used: denaturation at 95ºC for 30 s followed by annealing for 30s at 58, and elongation for 30s at 72ºC. The following sense and antisense primers were used: GACTGTGGGCTGGGCACACG TGGTATTTGCACTCCGCGCC for PTN. The relative mRNA expression levels were calculated by the comparative Ct method, normalized with the average expression of GAPDH.

Western blot analysis

Cells were collected and washed in lysis buffer. Protein lysates from cells was extracted and western blot analyses were performed as described previously. Briefly, the blots were incubated with different primary monoclonal antibodies, GAPDH and PTN overnight at 4°C, followed by horseradish peroxidase-conjugated goat anti-rabbit secondary antibody for 2 h at room temperature. Protein bands were visualized by enhanced chemiluminescence (ECL system; Amersham, UK) and quantified with densitometry using Image J software (NIH, USA).

Transient transfection

For siRNA transfection, experimental conditions were optimized. siRNA experiments were carried out in serum- and antibiotic-free Opti-MEM medium (GIBCO) using RNAi MAX transfect agent (Invitrogen). Cells were plated overnight at 50% to 70% confluence and then transfected with either scramble siRNA as a control or PTN-specific siRNAs (QIAGEN). Transfection efficiency was evaluated by quantitative real-time PCR. Cells were lysed or tested in functional assays 48 h after transfection.

Statistical analysis

The results were presented as mean standard deviation, and analyzed with SPSS software (version 22.0; SPSS Inc, Chicago, IL, USA). The significance of differences was determined by one-way analysis of variance among multiple groups, and P0.05 was considered statistically significant.

Results

Establishment of doxorubicin resistant osteosarcoma cell lines

The degree of resistance acquired by OS cells in response to continuous exposure to DOX over a period of 6 months was determined by CCK8 assay. The resistance factor (R factor) was defined as the ratio of the DOX-resistant cells IC 50 to the DOX-sensitive IC 50. As shown in Figure 1, when exposed to DOX for 48 h, the IC 50 value of HOS/DOX cells and MG63/DOX were 5 μM and 5.75 μM, whereas those of HOS cells and MG63 cells were 1.25 μM and 1.75 μM respectively. Obviously, continuous exposure to DOX made cells more resistant to DOX than their parental cells (P<0.05).

chemotherapy-performed-confirm

Figure 1: CCK8 assay was performed to confirm successful establishment of DOX resistant OS cell lines; Cell viability of HOS/ DOX; A) and MG63/DOX OS cells; B) clearly increased with time and concentration of DOX exposure compared to their parental cells.

PTN is significantly overexpressed in the doxorubicin-resistant osteosarcoma cell lines

To identify the potential PTN role involved in OS DOX resistance, the expression of PTN in the DOX resistant OS cell lines and their parental DOX sensitive OS cell lines were analyzed. According to the qRT-PCR analysis results, PTN level of mRNA were increased (P<0.05) in both HOS/DOX (Figure 2A) and MG63/DOX cell lines (Figure 2B). To validate the qRT-PCR analysis findings, we further detected the PTN protein expression by western blot analysis. The protein expression results (Figure 2C and 2D) were consistent with the mRNA expression data.

chemotherapy-Expression-PTN

Figure 2: Expression of PTN increased after doxorubicin resistance induced; PTN levels in HOS and MG63 cells and their DOXresistant cell lines using real-time PCR (A, B) and western blot (C, D).

Silencing PTN overcomes doxorubicin resistance in the established resistant osteosarcoma cell lines

To test the role of PTN in acquired DOX resistance, the effects of the PTN gene knockdown on DOX-induced cytotoxicity were examined in HOS/DOX and MG63/DOX cells. After transfection, PTN expressions in HOS/DOX (Figure 3A) and MG63/DOX cells (Figure 3B) were examined by qRT-PCR. Cells transfected either with si-scramble or si- PTN were treated with DOX for 48 h, and the CCK-8 assay was performed to detect the cell viability. As shown in Figure 3, the viability of cells transfected with si-PTN clearly decreased with the same time and concentration of DOX exposure than that of the control group did (P<0.05). These data clearly suggest that PTN could regulate the DOX sensitivity of OS.

chemotherapy-Knockdown-PTN

Figure 3: Knockdown of PTN could partly reverse the resistance of OS cells to doxorubicin. PTN mRNA levels were compared between si-scramble group and si-PTN group in HOS/DOX; A) and MG63/DOX cells; B). The cell proliferation of HOS/DOX and MG63/DOX OS cells was evaluated by the CCK-8 assay after exposed to DOX for 48 h; The results showed that the HOS/DOX; C) and MG63/DOX cells; D) transfected with si-PTN were more sensitive to the DOX treatment than the control groups.

PTN is overexpressed in clinical osteosarcoma samples and associated with patients’ survival

To further explore the clinical significance of PTN in the prognosis of OS, we examined the PTN expression in 20 OS tissues and 20 adjacent normal tissues of patients. As shown in Figure 4A, PTN was markedly high in the tumor tissues resected from the OS patients and low in the normal tissues (P<0.001). Subsequently, we divided 20 OS specimens into high- and low-PTN expression groups We found that the disease free survival time of the low PTN expression group was significantly longer than that of the high expression group (Figure 4B, P<0.05).

chemotherapy-Potential-clinical

Figure 4: Potential clinical significance of PTN. Analysis of PTN gene status in 20 OS tissues compared with normal tissues; A) Patients with high levels of PTN expression; B) Demonstrated reduced average disease free survival than the patients with low expression.

Discussion

OS is derived from osteoblast progenitor cells of mesenchymal origin and frequently arise during period of rapid bone growth [15]. These primary bone tumors have been the second highest cause of cancer-related death in children and adolescents [16]. DOX in combination with methotrexate and cisplatin is the most commonly used chemotherapy regimens. However, the occurrence of DOX resistance common in patients with advanced stage cancer impedes its clinical usage [17-19]. Over the past decades, a number of potential mechanisms attributing to chemoresistance in OS have been proposed, such as overexpression of ABC membrane transporter family members, disorders of cell death pathways and aberrant metabolic pathways [20-22]. Nevertheless, there are still no available methods to reverse chemoresistance in OS effectively. Therefore, there is an urgent need to identify new therapeutic targets to improve the therapeutic efficacy and predict the drug response for patients with OS.

Previous studies have shown that PTN, highly expressed in most tumors, was correlated with metastasis, poor survival and resistance against chemotherapy [23,24]. It was reported that implantation of PTN-transformed fibroblasts into nude mice induced aggressive tumors with cytoskeletal abnormalities, suggesting that PTN contributes to the proliferation and metastasis of malignant cells [25]. PTN serum levels have been found to be higher in lung cancer patients than healthy control subjects [26] and correlated with progression in melanoma patients [24], suggesting that PTN serum level may be a useful biomarker in early diagnosis and

In the present study, a gradually increasing dose of DOX was used to investigate acquired resistance in the DOX-resistant OS cell lines, HOS/DOX and MG63/DOX. Following six months of resistance-induction, the DOX-resistant cell lines were established compared with the primary OS cells. We found that PTN levels in DOX resistant cells were up-regulated compared to their parental DOX sensitive cells. Down-regulating PTN level in DOX resistant cell lines by using RNA interference could enhance the therapeutic efficacy of DOX treatment. Of note, we showed that PTN expression on mRNA level was significantly increased in primary tumors from OS patients as compared to adjacent normal tissue, which was in consistent with previous studies. Additionally, we demonstrated that increased PTN expression in OS was associated with inferior disease free survival. This is in accordance with previous results, indicating that elevated levels of PTN have a vital role in OS prognosis. Based on the data in this study, we suggest that PTN is a promising therapeutic target for OS patients.

Acknowledgments

This research was supported by National Natural Science Foundation of China (No. 81301882).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Article Usage

  • Total views: 54
  • [From(publication date):
    March-2017 - Mar 28, 2017]
  • Breakdown by view type
  • HTML page views : 36
  • PDF downloads :18
 
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

OMICS International Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
OMICS International Conferences 2016-17
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri, Food, Aqua and Veterinary Science Journals

Dr. Krish

agrifoodaquavet@omicsonline.com

1-702-714-7001 Extn: 9040

Clinical and Biochemistry Journals

Datta A

clinical_biochem@omicsonline.com

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

business@omicsonline.com

1-702-714-7001Extn: 9042

Chemical Engineering and Chemistry Journals

Gabriel Shaw

chemicaleng_chemistry@omicsonline.com

1-702-714-7001 Extn: 9040

Earth & Environmental Sciences

Katie Wilson

environmentalsci@omicsonline.com

1-702-714-7001Extn: 9042

Engineering Journals

James Franklin

engineering@omicsonline.com

1-702-714-7001Extn: 9042

General Science and Health care Journals

Andrea Jason

generalsci_healthcare@omicsonline.com

1-702-714-7001Extn: 9043

Genetics and Molecular Biology Journals

Anna Melissa

genetics_molbio@omicsonline.com

1-702-714-7001 Extn: 9006

Immunology & Microbiology Journals

David Gorantl

immuno_microbio@omicsonline.com

1-702-714-7001Extn: 9014

Informatics Journals

Stephanie Skinner

omics@omicsonline.com

1-702-714-7001Extn: 9039

Material Sciences Journals

Rachle Green

materialsci@omicsonline.com

1-702-714-7001Extn: 9039

Mathematics and Physics Journals

Jim Willison

mathematics_physics@omicsonline.com

1-702-714-7001 Extn: 9042

Medical Journals

Nimmi Anna

medical@omicsonline.com

1-702-714-7001 Extn: 9038

Neuroscience & Psychology Journals

Nathan T

neuro_psychology@omicsonline.com

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

John Behannon

pharma@omicsonline.com

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

social_politicalsci@omicsonline.com

1-702-714-7001 Extn: 9042

 
© 2008-2017 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version